View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10621_high_10 (Length: 248)
Name: NF10621_high_10
Description: NF10621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10621_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 32290505 - 32290748
Alignment:
| Q |
1 |
tttataaggcctgacccacatctccaatccagcaa-gtattcagtggcaaagtagttgcctttcccatttccaacgggttccggtggatcatcatcatca |
99 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32290505 |
tttataaggcctgacccacatctccaa-ccagcaaagcattcagtggcaaagtagttgcctttcccatttccaacgggttccggtggatcatcatcatca |
32290603 |
T |
 |
| Q |
100 |
ttgtgtcatatccttaaaataatagtatcatatatatcactagttaggaagagtatttaatttttgcgtnnnnnnngaaaaggaagagtatttaatttta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32290604 |
ttgtgtcatatccttaaaataatagtatcatatatatcactagttaggaagagtatttaatttttgcgtaaaaaaagaaaaggaagagtatttaatttta |
32290703 |
T |
 |
| Q |
200 |
gcaccaaccccaactgcatatgtatattttctctttcatctcagt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32290704 |
gcaccaaccccaactgcatatgtatattttctctttcatttcagt |
32290748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University