View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10621_high_12 (Length: 239)
Name: NF10621_high_12
Description: NF10621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10621_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 2702163 - 2701939
Alignment:
| Q |
1 |
tcatattttaataaacattataccataaaatataatatgatgcatgtgcaaaatattttacattgtaagtactttggtgaaaaaattctttgtaataagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2702163 |
tcatattttaataaacattataccataaaatataatatgatgcatgtgcaaaatattttacattgtaagtattttggtgaaaaaattctttgtaataagt |
2702064 |
T |
 |
| Q |
101 |
aacattattgtagagt-ttttattagggaacattattgtatagagttatttaacataataagtg-aaaagtaacaacattcctttgatgaggcaggtgtg |
198 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |||| ||| |||||||||||||||||| ||||||| |
|
|
| T |
2702063 |
aacattattgtagagtttttttttagggaacattattgtatagagttatttaacataataagtgaaaaactaaaaacattcctttgatgaggtaggtgtg |
2701964 |
T |
 |
| Q |
199 |
atagaattctatggtatggtaaagg |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2701963 |
atagaattctatggtatggtaaagg |
2701939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University