View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10621_low_10 (Length: 343)
Name: NF10621_low_10
Description: NF10621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10621_low_10 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 14 - 343
Target Start/End: Original strand, 2287555 - 2287884
Alignment:
| Q |
14 |
catagggcgatgagagttccttttcctaccctatgaatttttaaacacgcttctgtatggatttattcatctggcggacaaaatatcattttgtcgttca |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2287555 |
cataaggcgatgagagttccttttcctaccctatgaatttttaaacacgcttctgtatggatttattcatctggcggacaaaatatcattttgtcgttcg |
2287654 |
T |
|
| Q |
114 |
ggcttgcctatctagacaccagaaaaaatggtatttttccgtccgaatttgtaaatccagaggggtgcaattttcaagaaatgggtggggttaagtacct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2287655 |
ggcttgcctatctagacaccagaaaaaatggtatttttccgtccgaatttgtaaatccagaggggtgcaattttcaagaaatgggtggggttaagtacct |
2287754 |
T |
|
| Q |
214 |
ctctaaggtggttattaacttattattgagcctgttttatgggtgtgaggctaatatcaaaatattacttatgggttcttagccttttgatcagtttata |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2287755 |
ctctaaggtggttattaacttattattgagcctgttttatgggtgtgaggctaatatcaaaatattacttatgggttcttagccttttgatcagtttata |
2287854 |
T |
|
| Q |
314 |
tatattttgttaggagaataagattgtttt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2287855 |
tatattttgttaggagaataagattgtttt |
2287884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University