View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10621_low_13 (Length: 321)
Name: NF10621_low_13
Description: NF10621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10621_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 19 - 310
Target Start/End: Complemental strand, 49819710 - 49819420
Alignment:
| Q |
19 |
cctacaccaaatccaccatggttgatcaaaccacatcttacaacgatccaacctcttcagcacaaaaacatctcatagagtaaaaagtcaccactcaact |
118 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49819710 |
cctacaccaa-tccaccatggttgatcaaaccacatcttacaacgatccaacctcttcagcacaaaaacatctcatagagtaaaaagtcaccactcaact |
49819612 |
T |
 |
| Q |
119 |
acctatcaatcttaactctatcaactattttgtttggtacgtcaaaacagatccactatcttcttgttgctcgccatcttgttgaccatgtcatgaaagg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49819611 |
acctatcaatcttaactctatcaactattttgtttggtacgtcaaaacagatccactatcttcttgttgctcgacatcttgttgaccatgtcatgaaagg |
49819512 |
T |
 |
| Q |
219 |
ataaagaaacttctaattgttacagtacaaatttctctacatggtctttcttggcccgtgtgatcccgaagttcgtgatgcactattttcat |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49819511 |
ataaagaaacttctaattgttacagtacaaatttctcttcatggtctttcttggctcgtgtgatcccgaagttcgtgatgcactattttcat |
49819420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University