View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10621_low_21 (Length: 270)
Name: NF10621_low_21
Description: NF10621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10621_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 22 - 267
Target Start/End: Original strand, 40767008 - 40767253
Alignment:
| Q |
22 |
gccaagtgatatagttagtacttgtacagtttcaatcttagtaggtcttctcagaatcaagcagtagtgtgaaagtttgtgcaagtatctaatacttttc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40767008 |
gccaagtgatatagttagtacttgtacagtttcaatcttagtaggtcttctcagaatcaagcagtagtgtgaaagtttgtgcaagtatctaatacttttc |
40767107 |
T |
|
| Q |
122 |
attataaaaacttttgagaattttacagaatggattatcaaccagctgattcataaggatttgactatattttatctgttatgctttgtcatattcatca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40767108 |
attataaaaacttttgagaattttacagaatggattatcaaccagctgattcataaggatttgactatattttatctgttatgctttgtcatattcatca |
40767207 |
T |
|
| Q |
222 |
taccttaatagaattttccaagtttgttttcttcctttgcttctcc |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
40767208 |
taccttaatagaattttccaagtttgttttcttcttttgtttctcc |
40767253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University