View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10621_low_22 (Length: 269)

Name: NF10621_low_22
Description: NF10621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10621_low_22
NF10621_low_22
[»] chr4 (1 HSPs)
chr4 (1-79)||(32290012-32290090)


Alignment Details
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 32290090 - 32290012
Alignment:
1 gcggcatgagaattagaatttcttaatttgacatttttaaagacactcaacattctcaaacaactcacaaacataatta 79  Q
    ||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||||||||||| |||||    
32290090 gcggcatgagaattagaatttcttaatttgacattcttaaaaatactcaacattctcaaacaactcacaaacacaatta 32290012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University