View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10621_low_22 (Length: 269)
Name: NF10621_low_22
Description: NF10621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10621_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 32290090 - 32290012
Alignment:
| Q |
1 |
gcggcatgagaattagaatttcttaatttgacatttttaaagacactcaacattctcaaacaactcacaaacataatta |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32290090 |
gcggcatgagaattagaatttcttaatttgacattcttaaaaatactcaacattctcaaacaactcacaaacacaatta |
32290012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University