View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10621_low_24 (Length: 255)
Name: NF10621_low_24
Description: NF10621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10621_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 2 - 240
Target Start/End: Complemental strand, 11286189 - 11285951
Alignment:
| Q |
2 |
ttgaacaattttataattgtttgttgatgttagtgtgttaacattcaattttaatgtctttgtgtagcctggtccggaatctattggtatcgttgctgtt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11286189 |
ttgaacaattttataattgtttgttgatgttagtgtgttaacagtcaattttaatgtctttgtgtagcctggtccggaatctattggtatcgttgctgtt |
11286090 |
T |
 |
| Q |
102 |
tcccgcaactctagtgggatagcggcgcgagcctgcggccttgtgagtctggagcccactaaggtagtattttgttgttgatttgtttccttgttgctgt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11286089 |
tcccgcaactctagtgggatagcggcgcgagcctgtggccttgtgagtctagagcccactaaggtagtattttgttgttgatttgtttcctcgttgctgt |
11285990 |
T |
 |
| Q |
202 |
tgaacaatgaaactgtgattactttttaataacttgtct |
240 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
11285989 |
cgaacaatgaaattgtgattcctttttaataacttgtct |
11285951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University