View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10621_low_25 (Length: 254)
Name: NF10621_low_25
Description: NF10621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10621_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 14 - 240
Target Start/End: Complemental strand, 39578142 - 39577916
Alignment:
| Q |
14 |
gttgtaattaagtacacgagcaaacaannnnnnnngtacaattaagtcattctgttatgcaacagttactcaattgttagttattgccgacaagatatta |
113 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39578142 |
gttgtaattaagtacacgagcaaacaattttttttgtacaattaagtcattctgttatgcaacagttactcaattgttagttattgctgacaagatatta |
39578043 |
T |
 |
| Q |
114 |
tataaagaagtccctaaaccactataaacacagaaacagtattccatccaaaccgcaaacaaacagatgtaagcatgtaggtaggcaaaagaatataata |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39578042 |
tataaagaagtccctaaaccactataaacacagaaacagtattccatccaaaccgcaaacaaacagatgtaagcatgtaggtaggcaaaagcatataata |
39577943 |
T |
 |
| Q |
214 |
ctatagttccaagttttgatagattgt |
240 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
39577942 |
ctatagttccaagttttgatagattgt |
39577916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 184
Target Start/End: Complemental strand, 39541973 - 39541941
Alignment:
| Q |
152 |
gtattccatccaaaccgcaaacaaacagatgta |
184 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
39541973 |
gtattccatccgaaccgcaaacaaacagatgta |
39541941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University