View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10621_low_26 (Length: 251)
Name: NF10621_low_26
Description: NF10621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10621_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 2703144 - 2703385
Alignment:
| Q |
1 |
gcctcagatcgatgttagacggtacagaaatcaaactgattttaaannnnnnnnnnnnnnnactctaaaataccaagattaaaatatggactgtttgatt |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2703144 |
gcctcggatcgatgttagacggtacagaaatcaaactgattttgaattttattttttttt-actctaaaataccaagattaaaatatggattgtttgatt |
2703242 |
T |
 |
| Q |
101 |
ttgatccaacgaccaccaacatgcaaacaacgaatgtatgcgatatgttaccattgaagattcaaattccatatttgatggcatgtgatcnnnnnnnnnn |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
2703243 |
ttgatccaacgaccaccaatatgcaaacaacgaatgtatgcgatatgttaccattgaagattcaaa-tccatatttgatgacatgtgatcaaaaagaaaa |
2703341 |
T |
 |
| Q |
201 |
nngtataagcaagtggttactataccatgctggtgttctctgct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2703342 |
aagtataagcaagtggttactataccatgctggtgttctttgct |
2703385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University