View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10621_low_33 (Length: 240)
Name: NF10621_low_33
Description: NF10621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10621_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 66 - 221
Target Start/End: Original strand, 7760214 - 7760369
Alignment:
| Q |
66 |
agtcacaaatatttatgcacactatttgagtgcatacacatacttaagaaaggtggaagtaaacaacccattataccgttcctatcaaagtgacaaccca |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7760214 |
agtcacaaatatttatgcacactatttgagtgcatacacatacttaagaaaggtggaaatagacaacccattataccgttcctatcaaagtgacaaccta |
7760313 |
T |
 |
| Q |
166 |
aaacccgaccaaaccatttagaaaatcgatcaatattgaaccattgttaaccaccc |
221 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7760314 |
aaacccgaccaaactatttagaaaattgatcaatattgaaccattgttaaccaccc |
7760369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University