View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10621_low_38 (Length: 226)
Name: NF10621_low_38
Description: NF10621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10621_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 88 - 211
Target Start/End: Complemental strand, 43222711 - 43222588
Alignment:
| Q |
88 |
ttgtttgtaaaatgtttgcttctgattgtaggtaacatctatttctgataaaggcattcgattatcggagaaatgaacgggcttgtgggaatgaggaaaa |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43222711 |
ttgtttgtaaaatgtttgcttctgattgtaggtaacatctatttctgataaaggcattcgattatcggagaaatgaacgggcttgtgggaatgaggaaaa |
43222612 |
T |
|
| Q |
188 |
tcaagtctcagtgttcgatctctg |
211 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43222611 |
tcaagtctcagtgttcgatctctg |
43222588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 18 - 61
Target Start/End: Complemental strand, 43222781 - 43222738
Alignment:
| Q |
18 |
atgaccaccatgtatgtgttttacgtttccaatgccatcactgg |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43222781 |
atgaccaccatgtatgtgttttacgtttccaatgccatcactgg |
43222738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 159 - 202
Target Start/End: Complemental strand, 43222586 - 43222543
Alignment:
| Q |
159 |
aatgaacgggcttgtgggaatgaggaaaatcaagtctcagtgtt |
202 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||||| |
|
|
| T |
43222586 |
aatgaacgggcctgtgggaattaggaaaatcaggtctcagtgtt |
43222543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University