View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10622_low_10 (Length: 222)
Name: NF10622_low_10
Description: NF10622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10622_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 18 - 134
Target Start/End: Complemental strand, 47317614 - 47317498
Alignment:
| Q |
18 |
gtttgacttgtttctatcaaaaacttagaaagcttaacctgcatagtgcatgataatggttttggattttgtttcatgtatgagcacaaatgctctttta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47317614 |
gtttgacttgtttctatcaaaaacttagaaagcttaagctgcgtagtgcatgataatggttttggattttgtttcatgtacgagcacaaatgctctttta |
47317515 |
T |
|
| Q |
118 |
tacggcgtatattttat |
134 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
47317514 |
tacggcgtatattttat |
47317498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 126 - 207
Target Start/End: Complemental strand, 47317311 - 47317230
Alignment:
| Q |
126 |
atattttattactctgcaccaactttaacaaaaaagaaaatctgttatccacccattttttatgcaataccttattattcat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47317311 |
atattttattactctgcaccaactttaacaaaaaagaaaatctgttatccacccattttttatgccataccttattattcat |
47317230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University