View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10622_low_9 (Length: 239)
Name: NF10622_low_9
Description: NF10622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10622_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 37504135 - 37503913
Alignment:
| Q |
1 |
cagaattttgcctaagtgtagccacgcttttcatatcccttgtattgatacttggcttagttcacacaagaattgtccgctgtgtcgtgcacctgtgatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37504135 |
cagaattttgcctaagtgtagccacgcttttcatatcccttgtattgatacttggcttagttcacacaagaattgtccgctgtgtcgtgcacctgttatc |
37504036 |
T |
 |
| Q |
101 |
aatgatgctgcagaggtgagtatcacagtcactgatcaacttgattcaatttcaaatatttctgttgagactcagaatcaaggacatacagaaagctctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37504035 |
aatgatgctgcagaggtgagtatcacagtcactgatcaacttgattcaatttcaaatatttctggtgacactcagaatcaaggacatacagaaagctctg |
37503936 |
T |
 |
| Q |
201 |
ataatgctgttgggagaggatta |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37503935 |
ataatgctgttgggagaggatta |
37503913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 37227914 - 37227852
Alignment:
| Q |
6 |
ttttgcctaagtgtagccacgcttttcatatcccttgtattgatacttggcttagttcacaca |
68 |
Q |
| |
|
||||||| ||||||| ||| ||||||||| | ||||||||||||||||||||||| ||||||| |
|
|
| T |
37227914 |
ttttgccaaagtgtaaccatgcttttcatttaccttgtattgatacttggcttagatcacaca |
37227852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University