View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10623_low_1 (Length: 330)
Name: NF10623_low_1
Description: NF10623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10623_low_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 12 - 288
Target Start/End: Original strand, 29006989 - 29007265
Alignment:
| Q |
12 |
aggagcagagagtctacaatcaaattctcaaattgagtatacagagtttactttgaactaaacaagttcatttgctaacaaacaaattcacagtagcaaa |
111 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29006989 |
aggagcaaagagtctacaatcaaattctcaaattgagtatacagagtttactttgaactaaacaagttcatttgctaacaaacaaattcacagtagcaaa |
29007088 |
T |
 |
| Q |
112 |
gattctcacattagcaacacaagaacatcactcactttggaacaattgactaaagtcactaaaccaaatcacaatctatatgtactaaacaatatgtcat |
211 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29007089 |
gattctcacattagcaacacaagatcatcactcactttggaacaattgactaaagtcactaaaccaaatcacaatctatatgtactaaacaatatgtcat |
29007188 |
T |
 |
| Q |
212 |
tataaatgaccaaacacccacatcagtgaaataaactgtctagtgtgagctagctagttgatagctgaaaggtgaac |
288 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29007189 |
tatgaatgaccaaacacccacatcagtgaaataaactgtctagtgtgagctagctagttgatagctgaaaggtgaac |
29007265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University