View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10623_low_2 (Length: 303)
Name: NF10623_low_2
Description: NF10623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10623_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 53057267 - 53057550
Alignment:
| Q |
1 |
aaccaccaaccagtgaattggccagttttcggttcaattggtagaactggccgattcggtctgttttaaaacattgacatgaaaattgaagtaggatgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53057267 |
aaccaccaaccagtgaattggccagttttcggttcaattggtagaactggccgattcggtctgttttaaaacattgacatgaaaattgaagtaggatgta |
53057366 |
T |
|
| Q |
101 |
acatgaacaatagatttagacaacaatgaaaccaactaacatgtcagtctatgattatatgatgacagcagcagtggcaggcagtaccgaccataaagcc |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
53057367 |
acatgaacaatagatttaggcaacaatgaaaccaactaacatgtcagtttatgattatatgatgacagcagcagtggcaggcagtacctaccataaagcc |
53057466 |
T |
|
| Q |
201 |
cttaacagtagtacttaattcatctgcaactctggcctcagaaaatccaacacgaggtgaggcctaaagttatgtgggggaatc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53057467 |
cttaacagtagtacttaattcatctgcaactctggcctcagaaaatccaacacgaggtgaggcctaaagttatgtgggggaatc |
53057550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University