View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10624_15 (Length: 314)
Name: NF10624_15
Description: NF10624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10624_15 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 2287555 - 2287793
Alignment:
| Q |
13 |
catagggcgatgagagttccttttcctaccctatgaatttttaaacacgcttctgtatggatttattcatctggcggacaaaatatcattttgtcgttca |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2287555 |
cataaggcgatgagagttccttttcctaccctatgaatttttaaacacgcttctgtatggatttattcatctggcggacaaaatatcattttgtcgttcg |
2287654 |
T |
|
| Q |
113 |
ggcttgcctatctagacaccagaaaaaatggtatttttccgtccgaatttgtaaatccagaggggtgcaattttcaagaaatgggtggggttaagtacct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2287655 |
ggcttgcctatctagacaccagaaaaaatggtatttttccgtccgaatttgtaaatccagaggggtgcaattttcaagaaatgggtggggttaagtacct |
2287754 |
T |
|
| Q |
213 |
ctctaaggtggttattaacttattattgagcctgtttta |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2287755 |
ctctaaggtggttattaacttattattgagcctgtttta |
2287793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 245 - 314
Target Start/End: Original strand, 33160911 - 33160980
Alignment:
| Q |
245 |
tgttttagtgtgagctacaacatatctttttggttgtgtgaattatgttttggtttttactggtacgtag |
314 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33160911 |
tgtttgagtgtgagctacaacatatctttttggttgtgtgaattatgttttggtttttactggtatgtag |
33160980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University