View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_high_29 (Length: 276)
Name: NF10625_high_29
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_high_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 267
Target Start/End: Complemental strand, 42269915 - 42269660
Alignment:
| Q |
16 |
gtatatttgaaaagtccgtaatgacctttctcaagaagtaacttcgagactgagcagcaacatgttgatgggattatttttcattcttgggagtggttct |
115 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
42269915 |
gtatatttgaaaagttcgtaatgacctttctcaagaagtaacttcgagactgagcagcaacatgttgattggattatttttcattcttgggagtgattct |
42269816 |
T |
|
| Q |
116 |
ttagtaaattccctaggcgt--cgcagctccccttatgagtgggagacaaaaccaattcttt----gttgacacctttagggttcagtgttgtttgacac |
209 |
Q |
| |
|
|| |||||||| |||||| | ||| |||||||||| ||||||||||| |||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
42269815 |
ttggtaaattctctaggcatcgcgcggctccccttacgagtgggagac--aaccaattctttgtacgttgacacctttagggttcaatgttgtttgacac |
42269718 |
T |
|
| Q |
210 |
atatggatcttatgtgtctttgagggtttgggtggttccaggatttcgaggttcttct |
267 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42269717 |
atatggatcttatatgtctttgagggtttgggtggttccaggatttcgaggttcttct |
42269660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 31222497 - 31222444
Alignment:
| Q |
107 |
agtggttctttagtaaattccctaggcgtcgcagctccccttatgagtgggaga |
160 |
Q |
| |
|
|||||||||||| |||||||||||||| ||| |||||| |||||||||||||| |
|
|
| T |
31222497 |
agtggttctttaataaattccctaggcatcgttgctccctttatgagtgggaga |
31222444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University