View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_high_38 (Length: 249)
Name: NF10625_high_38
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_high_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 107 - 239
Target Start/End: Complemental strand, 21556637 - 21556504
Alignment:
| Q |
107 |
agttaaaaataagtttcaaataaaatgaattatgtgcatatgctttgtcacatcaatctaggttaaaagtaaatgata-cnnnnnnncctatgatatacg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
21556637 |
agttaaaaataagtttcaaataaaatgaattatgtgcatatgctttgtcacatcaatctgggttaaaagtaaatgatataaaaaaaaactatgatatacg |
21556538 |
T |
 |
| Q |
206 |
atcacagggtcgatcaattgtgtttatgtctctg |
239 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
21556537 |
atcatagggtcgatcaattgtgtttatgtctctg |
21556504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 21556743 - 21556690
Alignment:
| Q |
1 |
catttttatgagtgcttcctagtcttgtcaaatagtgcacaccacaattgagtg |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21556743 |
catttttatgagtgcttcctagtcttgtcaaatagtgcaccccacaattgagtg |
21556690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University