View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_high_46 (Length: 241)
Name: NF10625_high_46
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_high_46 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 129 - 241
Target Start/End: Complemental strand, 10052142 - 10052030
Alignment:
| Q |
129 |
tctctcacatatatgatgtttaatatttagttttccataaaaattttaattcacgcttgcacaccaacaaatatgacattagaacatgttcaatatgcct |
228 |
Q |
| |
|
|||||||| |||| ||||||||||||||| |||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10052142 |
tctctcacttatacgatgtttaatatttaattttccataaaatttctaattcacgcttgcacaccaacaaatatgacattagaacatattcaatatgcct |
10052043 |
T |
|
| Q |
229 |
ctaaaaacatatt |
241 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10052042 |
ctaaaaacatatt |
10052030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 20 - 86
Target Start/End: Complemental strand, 10052196 - 10052130
Alignment:
| Q |
20 |
taaagagaatttgacttcacatctctatctaaaacttgcatcatgtttatgaagtctctcacatata |
86 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
10052196 |
taaagagaatttgacttcaaatctctatttaaaacttgcatcatgtttatgaaatctctcacttata |
10052130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University