View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_high_49 (Length: 241)
Name: NF10625_high_49
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_high_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 18 - 187
Target Start/End: Complemental strand, 28189957 - 28189792
Alignment:
| Q |
18 |
ggagctgcggaggatgagacacatatggatttcctaggtagtacgccccacttctatttatagagaaatgaaccactaaaatgttaagactcatattttt |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28189957 |
ggagctgtggaggatgagacacatatggatttcctaggt--ta--ccccacttctatttatagagaaatgaaccactaaaatgttaagactcatattttt |
28189862 |
T |
|
| Q |
118 |
tggactctataatatacatatcttaaattgttttaaatttgaagtaaaatcttcagtatatgacaaacac |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28189861 |
tggactctataatatacatatcttaaattgttttaaatttgaagtaaaatcttcagtatatgacaaacac |
28189792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University