View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_high_56 (Length: 236)
Name: NF10625_high_56
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_high_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 10 - 213
Target Start/End: Original strand, 17143768 - 17143971
Alignment:
| Q |
10 |
gagagagaagaagagggttaaccaacctgagttggtgttttcagaggagaatttggtgcgggtgtagggagaagtgaagaagaagccatgaagaaggaag |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| || ||| |||||||| ||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17143768 |
gagatagaagaagagggttaaccaacctgagttggtgttttgagtggataatttggtccgggtatagggagaactgaagaagaagccatgaagaaggaag |
17143867 |
T |
 |
| Q |
110 |
atagcagtgatgatattgaggaaacagacaagaatggttgcgttcttgaaggagattctaagcttccaccattgttgtacctccattttttgttatgaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17143868 |
atagcagtgatgatattgaggaaacaaacaagaatggttgcgttcttgaaggagaatctaagcttccaccattgttgtacctccattttttgttatgatt |
17143967 |
T |
 |
| Q |
210 |
gaaa |
213 |
Q |
| |
|
|||| |
|
|
| T |
17143968 |
gaaa |
17143971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University