View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_high_57 (Length: 236)
Name: NF10625_high_57
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_high_57 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 4 - 128
Target Start/End: Original strand, 3048728 - 3048848
Alignment:
| Q |
4 |
gcacgttggggagaagcatatcacacacaatgaaagtttctacttccatcgttttataatatgaggagtagatgacagacagctatgtggagaaagtaga |
103 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3048728 |
gcacattggggagaagcatatcacacacaatgaaagtttctacttccatcgttttataatatgaggagtagat----gacagctatgtggagaaagtaga |
3048823 |
T |
|
| Q |
104 |
gtgattaaaatcaaacatagaaagc |
128 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3048824 |
gtgattaaaatcaaacatagaaagc |
3048848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University