View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_high_68 (Length: 210)
Name: NF10625_high_68
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_high_68 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 20 - 197
Target Start/End: Original strand, 28277675 - 28277854
Alignment:
| Q |
20 |
tttttattatgccagttttttccgagaaagaaagtctttccattcattttgattgaacaaatcaaatgcaactatgaacttattttttcttt--gatgta |
117 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28277675 |
tttttattatgtcagttttttccgagaaagaaaatctttccattcattttgattgaacaagtcaaatgcaactatgaacttattttttcttttatatgta |
28277774 |
T |
 |
| Q |
118 |
gctttcactgttgcaacatttttaacaaatgatttatatgtagaaggtcattgatgcaatgtccaagcttatcgtctctg |
197 |
Q |
| |
|
||| ||||||||||||||||||||| |||||||||||||||||| ||||||||| |||||||||||||||||||| |||| |
|
|
| T |
28277775 |
gctgtcactgttgcaacatttttaagaaatgatttatatgtagatggtcattgacgcaatgtccaagcttatcgtttctg |
28277854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University