View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_low_21 (Length: 337)
Name: NF10625_low_21
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 9e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 200 - 325
Target Start/End: Complemental strand, 35641885 - 35641760
Alignment:
| Q |
200 |
ggaacgatattttggtggttcaaggacaagggtttagataaggatgcttcacgagaagactttatcatctgtggtaagtcaccataccaaaacttgtagg |
299 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35641885 |
ggaacgatattttggtggttcaaggtcaaggatttagataaggatgcttcacgagaagactttatcatctgtggtaagtcaccataccaaaacttgtagg |
35641786 |
T |
 |
| Q |
300 |
aagttcctctcaccccttgttgccta |
325 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
35641785 |
aagttcctctcaccccttgttaccta |
35641760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University