View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_low_24 (Length: 334)
Name: NF10625_low_24
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 114 - 324
Target Start/End: Original strand, 1989318 - 1989528
Alignment:
| Q |
114 |
cactaatgggttcttatgaagcaaccaatgtggttcttgctaaagtcaaaaactttgaccctgaaaatgcttcaaaaatcatgggttttcttctaatgaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1989318 |
cactaatgggttcttatgaagcaaccaatgtggttcttgctaaagtcaaaaactttgaccctgaaaatgcttcaaaaatcatgggttttcttctcatgaa |
1989417 |
T |
 |
| Q |
214 |
ccttgaagaatatgaacttgttcgtttagcatgttgtcctgaccatgttcttcataaccttgctattagggtaaagacccatttgggtatgaacctatct |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1989418 |
ccttgaagaatatgaacttgttcgtttagcatgttgtcctgaccatgttcttcataaccttgctattagggtaaagacccatttgggtatgaacctatct |
1989517 |
T |
 |
| Q |
314 |
accccttcttc |
324 |
Q |
| |
|
||||||||||| |
|
|
| T |
1989518 |
accccttcttc |
1989528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 17 - 77
Target Start/End: Original strand, 1989219 - 1989279
Alignment:
| Q |
17 |
atcaacaccatttcttgataccctttactctctttctagcatttgtcacttcaaaatttga |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1989219 |
atcaacaccatttcttgataccctttactctctttctatcatttgtcacttcaaaatttga |
1989279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 170 - 207
Target Start/End: Original strand, 12080745 - 12080782
Alignment:
| Q |
170 |
gaccctgaaaatgcttcaaaaatcatgggttttcttct |
207 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
12080745 |
gaccctgaaaatgcttcaaaaataatgggtttacttct |
12080782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University