View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_low_28 (Length: 301)
Name: NF10625_low_28
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 49 - 287
Target Start/End: Original strand, 9862794 - 9863041
Alignment:
| Q |
49 |
attttgaatttgttgatgaaaatagtgaaagcagtgaaaacaacgaagatgaagaagataatggattggttcctgcagcaaagtcatgtgttgagggatt |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9862794 |
attttgaatttgttgatgaaaatagtgaaagcagtgaaaacagcgaagatgaagaagataatggattggttcctgcggcaaagtcatgtgttgagggatt |
9862893 |
T |
 |
| Q |
149 |
ggaggaagttgaaaaggagagaaaatgtgctatttgttttgaagatttt-aagtttgtcttagtatgccatgtt--------tttcattcaaaaccctct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9862894 |
ggaggaagttgaaaaggagagaaaatgtgctatttgttttgaagattttaaagtttgtcttagtatgccatgtttgcacacatttcattcaaaaccctct |
9862993 |
T |
 |
| Q |
240 |
atgtaggtttaagttgtcaactagaacaagtgaatgaagggtaccttt |
287 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9862994 |
atgtaagtttaagttgtcaactagaacaagtgaatgaagggtaccttt |
9863041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 171 - 199
Target Start/End: Original strand, 9857967 - 9857995
Alignment:
| Q |
171 |
aaatgtgctatttgttttgaagattttaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9857967 |
aaatgtgctatttgttttgaagattttaa |
9857995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University