View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_low_34 (Length: 280)
Name: NF10625_low_34
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_low_34 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 14 - 280
Target Start/End: Complemental strand, 485917 - 485650
Alignment:
| Q |
14 |
cagagaggatgacgtggttgttaacttttagagttgagtcggatagggtgaaggtgaagggtgaattaggacaagggttaacatgtttggtggtggtgat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
485917 |
cagagaggatgacgtggttgttaacttttagagttgagtcggatagggtgaaggtgaagggtgaattgggacaagggttaacatgtttggtggtggtgat |
485818 |
T |
|
| Q |
114 |
aatgttgtcggtgttgtttctggttgagtttagggtagggtttggaggagacannnnnnnnaggctagggtttctaattgagaatgagaaagttggaatg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
485817 |
aatgttgtcggtgttgtttctggttgagtttagggtagggtttggaggagacattttttttaggctagggtttctaattgagaatgagaaagttggaatg |
485718 |
T |
|
| Q |
214 |
gtgtatgtgt-atgttaacgtgagagaagaaaggtgctagtgttcgtatatatatagaattttgtggt |
280 |
Q |
| |
|
|| |||||| ||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
485717 |
atggatgtgtaatgttaacgtgagagaagaaaggtgctagtgtttgtgtatatatagaattttgtggt |
485650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University