View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10625_low_37 (Length: 276)

Name: NF10625_low_37
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10625_low_37
NF10625_low_37
[»] chr1 (1 HSPs)
chr1 (16-267)||(42269660-42269915)
[»] chr5 (1 HSPs)
chr5 (107-160)||(31222444-31222497)


Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 267
Target Start/End: Complemental strand, 42269915 - 42269660
Alignment:
16 gtatatttgaaaagtccgtaatgacctttctcaagaagtaacttcgagactgagcagcaacatgttgatgggattatttttcattcttgggagtggttct 115  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||    
42269915 gtatatttgaaaagttcgtaatgacctttctcaagaagtaacttcgagactgagcagcaacatgttgattggattatttttcattcttgggagtgattct 42269816  T
116 ttagtaaattccctaggcgt--cgcagctccccttatgagtgggagacaaaaccaattcttt----gttgacacctttagggttcagtgttgtttgacac 209  Q
    || |||||||| |||||| |  ||| |||||||||| |||||||||||  ||||||||||||    |||||||||||||||||||| |||||||||||||    
42269815 ttggtaaattctctaggcatcgcgcggctccccttacgagtgggagac--aaccaattctttgtacgttgacacctttagggttcaatgttgtttgacac 42269718  T
210 atatggatcttatgtgtctttgagggtttgggtggttccaggatttcgaggttcttct 267  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
42269717 atatggatcttatatgtctttgagggtttgggtggttccaggatttcgaggttcttct 42269660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 31222497 - 31222444
Alignment:
107 agtggttctttagtaaattccctaggcgtcgcagctccccttatgagtgggaga 160  Q
    |||||||||||| |||||||||||||| |||  |||||| ||||||||||||||    
31222497 agtggttctttaataaattccctaggcatcgttgctccctttatgagtgggaga 31222444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University