View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_low_46 (Length: 250)
Name: NF10625_low_46
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_low_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 326263 - 326373
Alignment:
| Q |
1 |
cctattctcaaaatgatgagaccgacataaatttcaaatataaagagtgtgctgaaaaagaatctataagcaaaacgagtgcttctggcattgcactcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
326263 |
cctattctcaaaatgatgagaccgacataaatttcaaatataaagagtgtgctgaaaaagaatctataagcaaaacgagtgcttctggcattgcactcat |
326362 |
T |
|
| Q |
101 |
ggaggagcatt |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
326363 |
ggaggagcatt |
326373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 65 - 242
Target Start/End: Complemental strand, 531176 - 531000
Alignment:
| Q |
65 |
tataagcaaaacgagtgcttctggcattgcactcatggaggagcattgaatgataatttagaacagcccactccttaaggaggctcctccttatggtttt |
164 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
531176 |
tataagcaaaacgagtgcttccggcattgcactccccgaggagcattgaataataatttagaacagcccactccttaaggaggctcttcctcatggtttt |
531077 |
T |
|
| Q |
165 |
cccgtgcacagatctctaggtctatactttctttaagctacccagctttttgagctcccagacgccatttcctttgct |
242 |
Q |
| |
|
||| ||||| ||||| || || ||||||||||||||||||||||| ||||||||||||||| | ||||||||||||| |
|
|
| T |
531076 |
cccatgcacggatctatatgtttatactttctttaagctacccaggtttttgagctcccag-ccacatttcctttgct |
531000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 68 - 242
Target Start/End: Complemental strand, 517924 - 517752
Alignment:
| Q |
68 |
aagcaaaacgagtgcttctggcattgcactcatggaggagcattgaatgataatttagaacagcccactccttaaggaggctcctccttatggttttccc |
167 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| |||||||||||||| | ||||||||| |||||||| || || ||||||| |||| |||||||| || |
|
|
| T |
517924 |
aagcaaaatgagtgcttcttgcattgcactcttggaggagcattgactacaaatttagaatagcccacttctgaaagaggctcttcctcatggtttttcc |
517825 |
T |
|
| Q |
168 |
gtgcacagatctctaggtctatactttctttaagctacccagctttttgagctcccagacgccatttcctttgct |
242 |
Q |
| |
|
|||| |||||| |||| |||||||| ||||||||||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
517824 |
ttgcatggatctcctggtcaatactttc-ttaagctacccaggtttttgaactcccagac-acatttcctttgct |
517752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University