View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_low_47 (Length: 250)
Name: NF10625_low_47
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 49158475 - 49158234
Alignment:
| Q |
1 |
tgaattacattctatttataatgtgatatatgatgcatatgcaattgtaggcaaactcagaggtgtctgcattgcttggtcgcatcccatctgccgttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49158475 |
tgaattacattctatttataatgtgatatatgatgcatatgcaattgtaggcaaactcagaggtgtctgcattgcttggtcgcatcccatctgccgttgg |
49158376 |
T |
|
| Q |
101 |
ttatcaaccaacattgtctactgatcttggaggtcttcaagagcgtattacaaccaccaagaagggttcaattacctctgtccaagccatctatgtgcct |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49158375 |
ttatcaaccaacgttgtctactgatcttggaggtcttcaagagcgtattacaaccaccaagaagggttcaattacctctgtccaagccatctatgtgcct |
49158276 |
T |
|
| Q |
201 |
gctgatgacttgacagatcctgctcctgctaccacctttgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49158275 |
gctgatgacttgacagatcctgctcctgctaccacctttgct |
49158234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 21 - 242
Target Start/End: Complemental strand, 49153526 - 49153304
Alignment:
| Q |
21 |
atgtgatatatgatgcat-atgcaattgtaggcaaactcagaggtgtctgcattgcttggtcgcatcccatctgccgttggttatcaaccaacattgtct |
119 |
Q |
| |
|
|||||||||||||||| | ||| | ||||||| ||||||||||||||||| |||||||||| || |||||||| |||||||| ||||||||||||||| |
|
|
| T |
49153526 |
atgtgatatatgatgcctgatgtcactgtaggctaactcagaggtgtctgccctgcttggtcgtattccatctgcggttggttaccaaccaacattgtct |
49153427 |
T |
|
| Q |
120 |
actgatcttggaggtcttcaagagcgtattacaaccaccaagaagggttcaattacctctgtccaagccatctatgtgcctgctgatgacttgacagatc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
49153426 |
actgatcttggaggtcttcaagagcgtattacaaccaccaagaagggttcaattacatctgtccaggctatctatgtgcctgctgatgacttgacagatc |
49153327 |
T |
|
| Q |
220 |
ctgctcctgctaccacctttgct |
242 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
49153326 |
ctgctcctgctaccacctttgct |
49153304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 72 - 118
Target Start/End: Original strand, 27960569 - 27960615
Alignment:
| Q |
72 |
ttgcttggtcgcatcccatctgccgttggttatcaaccaacattgtc |
118 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||| |||| |
|
|
| T |
27960569 |
ttgcttggtcgtatcccatcggctgttggttatcaaccaacactgtc |
27960615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University