View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_low_48 (Length: 250)
Name: NF10625_low_48
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_low_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 14 - 236
Target Start/End: Complemental strand, 44704701 - 44704479
Alignment:
| Q |
14 |
agaccgtacgattcttgttaaattatgtccactnnnnnnntgagtgattgcaaattaacaaatccctttatagatttgtgtgtgtgtatagtttacatta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44704701 |
agaccgtacgattcttgttaaattatgtccactaaaaaaatgagtgattgcaaattaacaaatccctttatagatttgtgtgtgtgtatagtttacatta |
44704602 |
T |
|
| Q |
114 |
actatattttgttttatagtagtataactgttcataagtcaactattaccggtgctatgctactagcctactacaacacaacggtaatcatatattattg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44704601 |
actatattttgttttatagtagtataactgttcataagtcaactattaccggtgctatgctactagcctactacaacacaacggtaatcatatattattc |
44704502 |
T |
|
| Q |
214 |
aagctaaaatcatagtttatttt |
236 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44704501 |
aagctaaaatcatagtttatttt |
44704479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University