View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10625_low_49 (Length: 249)

Name: NF10625_low_49
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10625_low_49
NF10625_low_49
[»] chr3 (2 HSPs)
chr3 (107-239)||(21556504-21556637)
chr3 (1-54)||(21556690-21556743)


Alignment Details
Target: chr3 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 107 - 239
Target Start/End: Complemental strand, 21556637 - 21556504
Alignment:
107 agttaaaaataagtttcaaataaaatgaattatgtgcatatgctttgtcacatcaatctaggttaaaagtaaatgata-cnnnnnnncctatgatatacg 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||          ||||||||||||    
21556637 agttaaaaataagtttcaaataaaatgaattatgtgcatatgctttgtcacatcaatctgggttaaaagtaaatgatataaaaaaaaactatgatatacg 21556538  T
206 atcacagggtcgatcaattgtgtttatgtctctg 239  Q
    |||| |||||||||||||||||||||||||||||    
21556537 atcatagggtcgatcaattgtgtttatgtctctg 21556504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 21556743 - 21556690
Alignment:
1 catttttatgagtgcttcctagtcttgtcaaatagtgcacaccacaattgagtg 54  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||    
21556743 catttttatgagtgcttcctagtcttgtcaaatagtgcaccccacaattgagtg 21556690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University