View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_low_5 (Length: 450)
Name: NF10625_low_5
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 148 - 440
Target Start/End: Original strand, 37823611 - 37823888
Alignment:
| Q |
148 |
caaaatctatggagctcttggaccttgcacatctcttaggaaaaagaacggtcactgaccaaacttgcattgcttttttcttctaagctagtgttaaaca |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
37823611 |
caaaatctatggagctcttggaccttgcacatctcttaggaaaaagaacggtcactgaccaaacttgcattgcttttttcttccaagctagtgataaaca |
37823710 |
T |
|
| Q |
248 |
gaccattgaacccgactctgcttccaagcactgctgtttttgttaaacctgttttagcgaaggctgaatagtttagtttaacatgacacaactaatgagc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37823711 |
gaccattgaacccgactctgcttccaagcactgctgttttagt---------------gaaggctgaatagtttagtttaacatgacacaactaatgagc |
37823795 |
T |
|
| Q |
348 |
caacattatggtagcatttttatttattatttaacaaacctttgaatcaagtaattttcatttctcaagtttaaaaattaagttttgcctatg |
440 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37823796 |
caacattatggtagcatttttatttattatttaacaaacctttgaatcaagtaattttcatttctcaagtttaaaaattaagttttgcctatg |
37823888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 12 - 89
Target Start/End: Original strand, 37823309 - 37823386
Alignment:
| Q |
12 |
agaatcatggtcttcgcttctgaacctggactggttttggactctgatttctggcaatcaatgagaacccacaatgac |
89 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37823309 |
agaatcatggtcttcgcttctggacctggactggttttggactctgatttctggcaatcaatgagaacccacaatgac |
37823386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 104 - 142
Target Start/End: Original strand, 37823397 - 37823435
Alignment:
| Q |
104 |
gcaatggacatcttgcagtttatataagcagattgctaa |
142 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
37823397 |
gcaatggacatcttgcagtttatacaagcaaattgctaa |
37823435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 35 - 89
Target Start/End: Complemental strand, 47597904 - 47597850
Alignment:
| Q |
35 |
acctggactggttttggactctgatttctggcaatcaatgagaacccacaatgac |
89 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
47597904 |
acctggactggttgtggactctgatttccggcaatccatgagaacccacaatgac |
47597850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 199 - 254
Target Start/End: Complemental strand, 47597440 - 47597385
Alignment:
| Q |
199 |
tcactgaccaaacttgcattgcttttttcttctaagctagtgttaaacagaccatt |
254 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
47597440 |
tcactgaccgaacttgcattgcttttttcttccaagttagtgataaacagaccatt |
47597385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 148 - 197
Target Start/End: Complemental strand, 47597550 - 47597501
Alignment:
| Q |
148 |
caaaatctatggagctcttggaccttgcacatctcttaggaaaaagaacg |
197 |
Q |
| |
|
|||||| | |||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
47597550 |
caaaatttctggagctcttggaccttgcatgtctcttagaaaaaagaacg |
47597501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University