View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_low_52 (Length: 246)
Name: NF10625_low_52
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_low_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 35 - 235
Target Start/End: Original strand, 308553 - 308752
Alignment:
| Q |
35 |
atctgaaataattgaaactcaaacatattgagtacaatttccttgtctagaactcaaattaatcttgggggagattgaaggtcgagctccgacgaagatg |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| || |
|
|
| T |
308553 |
atctgaaataattgaaactcaaacatattgactgcaatttccttgtctagaactcaaattaatcttgggg-agattgaaggtcgagcttcgacgaaggtg |
308651 |
T |
|
| Q |
135 |
tgggtgtcatcattagacgggtcctatatcgtgataagttaacccttattctatctactagagtcaactcggtgtaatacttgaccatcccattgttctc |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
308652 |
tgggtgtcatcattagacgggtcctatatcgtgataagttaacccttattccatctactagagtcaactcggtgtaatgctcgaccatcccattgttctc |
308751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University