View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_low_53 (Length: 243)
Name: NF10625_low_53
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_low_53 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 243
Target Start/End: Complemental strand, 2154593 - 2154369
Alignment:
| Q |
19 |
atttggtgatttgaatcaactatttggtaaaaatacatgtgagtaactttaacataaaatatagggttaggaattgctctttaatgcttccaatattgga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2154593 |
atttggtgatttgaatcaactatttggtaaaaatacatgtgagtaactttaacataaaatatagggttaggaattgctctttaatgcttccaatattgga |
2154494 |
T |
 |
| Q |
119 |
gaagacaggttgctcctaagaagtcattaaattttttatggtaacataaaaatatcattttctgggccccttgtaaaactcagaaagcaatcacattcat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2154493 |
gaagacaggttgctcctaagaagtcattaaattttttatggtaacataaaaatatcattttctggggcccttgtaaaactcagaaagcaatcacattcat |
2154394 |
T |
 |
| Q |
219 |
tggttcagatgttttcaacaatttt |
243 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
2154393 |
tggttcagatgttttcaacattttt |
2154369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University