View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_low_56 (Length: 241)
Name: NF10625_low_56
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_low_56 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 3294487 - 3294715
Alignment:
| Q |
1 |
ctagtactcttcccatctcgtacttgccaaataacatgtgtgctttcacttcttccattggnnnnnnnnnnnnnnnnn--ctcaatattatcactaatta |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3294487 |
ctagtactcttcccatctcgtacttgccaaataacatgtgtgctttcacttcttccattggaaaaaaataaaaataaaaactcaatattatcactaatta |
3294586 |
T |
|
| Q |
99 |
agctagtaagtacttcataattagnnnnnnnn--gggatttgatttgtgggtttttctttaaggttgttgatgatttaggctataaggaagggaagaaga |
196 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3294587 |
agctagtaattacttcataattagttttttttttgggatttgatttgtgggtttttctttaaggttgttgatgatttaggctataaggaagggaagaaga |
3294686 |
T |
|
| Q |
197 |
gggtggaggagacttagaggaatgttggt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3294687 |
gggtggaggagacttagaggaatgttggt |
3294715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University