View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_low_61 (Length: 241)
Name: NF10625_low_61
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_low_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 40276237 - 40276410
Alignment:
| Q |
1 |
attaaattcatgccataagaaactgaattgaagtgatat--atatttaaagcaactttcaagttttggcttttgtggtgagaatgagttaaaaatgttaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40276237 |
attaaattcatgccataagaaactgaattgaagtgatatatatatttaaagaaactttcaagttttggcttttgtggtgagaatgagttaaaaatgttaa |
40276336 |
T |
 |
| Q |
99 |
tgtccttattaactagttgaagaagcaatcataagccgtaaccttttttgtccttaacatgtcacgtcatgctt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40276337 |
tgtccttattaactagttgaagaagcaatcataagccgtaacctcttttgtccttaacatgtcacgtcatgctt |
40276410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 40276428 - 40276508
Alignment:
| Q |
157 |
atgtcacgtcatgcttaattgattcagtaaaataaaatttaataatattcatgatttcgttaaactatagatagctatctct |
238 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40276428 |
atgtcacgtcatgcttaattgatttagtaaaataaaatttaat-atattcatgatttcgttaaactatagatagctatctct |
40276508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University