View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10625_low_68 (Length: 236)

Name: NF10625_low_68
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10625_low_68
NF10625_low_68
[»] chr6 (1 HSPs)
chr6 (4-128)||(3048728-3048848)


Alignment Details
Target: chr6 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 4 - 128
Target Start/End: Original strand, 3048728 - 3048848
Alignment:
4 gcacgttggggagaagcatatcacacacaatgaaagtttctacttccatcgttttataatatgaggagtagatgacagacagctatgtggagaaagtaga 103  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||    
3048728 gcacattggggagaagcatatcacacacaatgaaagtttctacttccatcgttttataatatgaggagtagat----gacagctatgtggagaaagtaga 3048823  T
104 gtgattaaaatcaaacatagaaagc 128  Q
    |||||||||||||||||||||||||    
3048824 gtgattaaaatcaaacatagaaagc 3048848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University