View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_low_69 (Length: 236)
Name: NF10625_low_69
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_low_69 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 17577126 - 17576909
Alignment:
| Q |
1 |
atccttgccacatcctgcgataaaaatcatttaatcatcatttcattatggagcaatttcaatcacaaaagtgggnnnnnnnnttaagcaataagatgga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17577126 |
atccttgccacatcctgcgataaaaatcatttaatcatcatttcattatggagcaatttcaatcacaaaagtgggaaaaaa--ttaagcaataagatgga |
17577029 |
T |
 |
| Q |
101 |
gtcaaaattatatcacaagaaagcaaactggtttatctaatgctaacaagtaacctgaatactactaacctttatgccacgagatattgttatggttttt |
200 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17577028 |
gtcagaattatatcacaggaaagcaaactggtttatctaatgctaacaagtaacctgaatactactaacctttatgccacgaggtattgttatggttttt |
17576929 |
T |
 |
| Q |
201 |
agtaaaaagggagttgtagc |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
17576928 |
agtaaaaagggagttgtagc |
17576909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University