View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_low_77 (Length: 228)
Name: NF10625_low_77
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_low_77 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 58 - 211
Target Start/End: Complemental strand, 38177376 - 38177223
Alignment:
| Q |
58 |
aaattggaattgggatttgattgcagccatttttaatgaacaagataggaaggttatatccaaactggtgctgttgcatcgagatagagaggacaagcgc |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38177376 |
aaattggaattgggatttgattgcagccatttttaatgaacaagataggaaggctatatccaaactggtgctgttgcatcgagatagagaggacaagcgc |
38177277 |
T |
|
| Q |
158 |
atatggaaatttaatagtcagggagtttatacggtaaagtccgcatatagatat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38177276 |
atatggaaatttaatagtcagggagtttatacggtaaagtccgcatatagatat |
38177223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 108
Target Start/End: Original strand, 34211722 - 34211799
Alignment:
| Q |
31 |
gaaggtagcagatttgatgagtggagaaaattggaattgggatttgattgcagccatttttaatgaacaagataggaa |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||| |||| |||| ||||||||||| || |||||||| |
|
|
| T |
34211722 |
gaaggttgcagatttgatgagtggagaaagctggaattgggggatgatagcagggatttttaatgatcatgataggaa |
34211799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 96
Target Start/End: Complemental strand, 18978345 - 18978278
Alignment:
| Q |
29 |
atgaaggtagcagatttgatgagtggagaaaattggaattgggatttgattgcagccatttttaatga |
96 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||| |||| |||| ||||||||||| |
|
|
| T |
18978345 |
atgaaggttgcagatttgatgagtggagaaagctggaattgggggatgatagcagggatttttaatga |
18978278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University