View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10625_low_78 (Length: 224)

Name: NF10625_low_78
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10625_low_78
NF10625_low_78
[»] chr3 (1 HSPs)
chr3 (1-214)||(40275946-40276159)


Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 40275946 - 40276159
Alignment:
1 taatcttcgttgcttcatctctcacgactgtcatattatatgataccttctacagccattggaacggcaaatgttcttaaacatccatttcttatcaata 100  Q
    ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
40275946 taatcttcgttgctttatctctcatgactgtcatattatatgataccttctacagccattggaacggcaaatgttcttaaacatccatttctcatcaata 40276045  T
101 catgttttgttatattagtatctttttgcttgcttggttatggttgcaaagtcttttgtagaggaacatgatacgtccactcttggctacttgactttct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40276046 catgttttgttatattagtatctttttgcttgcttggttatggttgcaaagtcttttgtagaggaacatgatacgtccactcttggctacttgactttct 40276145  T
201 tgttgcttcctttg 214  Q
     |||||||||||||    
40276146 agttgcttcctttg 40276159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University