View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10625_low_78 (Length: 224)
Name: NF10625_low_78
Description: NF10625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10625_low_78 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 40275946 - 40276159
Alignment:
| Q |
1 |
taatcttcgttgcttcatctctcacgactgtcatattatatgataccttctacagccattggaacggcaaatgttcttaaacatccatttcttatcaata |
100 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40275946 |
taatcttcgttgctttatctctcatgactgtcatattatatgataccttctacagccattggaacggcaaatgttcttaaacatccatttctcatcaata |
40276045 |
T |
|
| Q |
101 |
catgttttgttatattagtatctttttgcttgcttggttatggttgcaaagtcttttgtagaggaacatgatacgtccactcttggctacttgactttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40276046 |
catgttttgttatattagtatctttttgcttgcttggttatggttgcaaagtcttttgtagaggaacatgatacgtccactcttggctacttgactttct |
40276145 |
T |
|
| Q |
201 |
tgttgcttcctttg |
214 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40276146 |
agttgcttcctttg |
40276159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University