View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10626_low_6 (Length: 243)
Name: NF10626_low_6
Description: NF10626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10626_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 111 - 233
Target Start/End: Original strand, 29772104 - 29772230
Alignment:
| Q |
111 |
ccaacaatttcttcgatgatcccatgtcattggccaagcatcttagtcattaactcgatcatttagtataaatcaaatgtaatcagttcatcttgat--- |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29772104 |
ccaacaatttcttcgatgatcccatgtcattggccaagcatcttagtcattaactcgatcatttagtataaatcaaatgtaatcagttgatcttgattat |
29772203 |
T |
|
| Q |
208 |
-catacactcactcgattattcctatg |
233 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
29772204 |
acatacactcactcgattattcctatg |
29772230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University