View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10627_high_4 (Length: 313)
Name: NF10627_high_4
Description: NF10627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10627_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 43556993 - 43556729
Alignment:
| Q |
1 |
agggtgatgaacaagaagatattttacgtcgtggaagagaatgagaatctttgaaagatatgacatttgaagggtcgtcgatggtttgagaaggtttggg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
43556993 |
agggtgatgaacaagaagatattttacgtcgtggaagagaatgagaatctttgaaagatatgatatctgaagggtcgtcgatggtttgagaaggtttggg |
43556894 |
T |
 |
| Q |
101 |
tttggaaatagggtgaaagggtagtacagtagtgttggaggagatggggggtgcaaatagtggtttttccataacatcagttaagtgttgtttggttttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43556893 |
tttggaaatagggtgaaagggtagtacagtagtgttggaggagatggggggtgcaaatagcggtttttccataacatcagttaagtgttgtttggttttg |
43556794 |
T |
 |
| Q |
201 |
caggatccaaatgaggatcggaacatgcgagagattctcattttgagacggttttggttttccat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43556793 |
caggatccaaatgaggatcggaacatgcgagagattctcattttgagacggttttggttttccat |
43556729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University