View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10627_low_11 (Length: 227)
Name: NF10627_low_11
Description: NF10627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10627_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 35800466 - 35800354
Alignment:
| Q |
1 |
accatcatcaagtgggtcagtggagatcctcctcttcatcctataacggaaaaccacctttaggttcgttcgttcttcagtttttgcatggattgatctt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35800466 |
accatcatcaagtgggtctgtggagatcctcctcttcatcctataacggaaaaccacctttaggttcgttcgttcttcagtttttgcatggattgatctt |
35800367 |
T |
|
| Q |
101 |
tgatgtgaaactg |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35800366 |
tgatgtgaaactg |
35800354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 148 - 227
Target Start/End: Complemental strand, 35800320 - 35800241
Alignment:
| Q |
148 |
gatgcatagtagaaaaagtgggtgaatgttagaaattagaattgataaatatatcatgatattgtgaatagttgctgtca |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35800320 |
gatgcatagtagaaaaagtgggtgaatgttagaaattagaattgataaatatatcatgatattgtgaatagttgctgtca |
35800241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 113
Target Start/End: Complemental strand, 35790220 - 35790180
Alignment:
| Q |
73 |
ttcttcagtttttgcatggattgatctttgatgtgaaactg |
113 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
35790220 |
ttcttcagtttttgcatggattactctttgatgtcaaactg |
35790180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University