View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10628_low_13 (Length: 232)
Name: NF10628_low_13
Description: NF10628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10628_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 19 - 216
Target Start/End: Original strand, 7108938 - 7109135
Alignment:
| Q |
19 |
caagattacctccaaaagatctattatggagaagatcggttgcctctcaagtgaggttgatacactctttgatttgtctttgttgaataaatcctctttg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
7108938 |
caagattacctccaaaagatctattatggcgaagatcgggtgcctctcaagtgaggttgatgcactctttgatttgtctgtgttgaataaattctctttg |
7109037 |
T |
 |
| Q |
119 |
atgattagaaatgaggttaggcatgattctagctaacctttcagcaatcactttggttataattttaaacttgaagttatctaaagctataggcctat |
216 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7109038 |
ctgcttagaaatgaggttaggcatgattctagctaacctttcagcaatcactttggttataattttaaacttgaagttatctaaagctataggtctat |
7109135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University