View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10628_low_14 (Length: 232)
Name: NF10628_low_14
Description: NF10628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10628_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 49 - 213
Target Start/End: Original strand, 43179528 - 43179701
Alignment:
| Q |
49 |
tcttacgtggttcgaaggattaatatctacagttgcatgtaaaatatccaattcacatnnnnnnnn---------tggaaaggaaaaacaaatatttagt |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43179528 |
tcttacgtggttcgaaggattaatatctacagttgcatgtaaaatattcaattcacataacaaaaaaaataataatggaaaggaaaaacaaatatttagt |
43179627 |
T |
|
| Q |
140 |
ggttttttgcatctaagttcttataactcggaaaatatgataannnnnnnnnatcaaagcaaatatgataattg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43179628 |
ggttttttgcacctaagttcttataactcggaaaatatgataatttttttttatcaaagcaaatatgataattg |
43179701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University