View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10628_low_17 (Length: 213)
Name: NF10628_low_17
Description: NF10628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10628_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 16 - 195
Target Start/End: Original strand, 47452889 - 47453068
Alignment:
| Q |
16 |
atgaatggaagtatgaggatcggcgtagtctaaggatgttgcaaaagtgacttttcgtctgttccaaggcagctacaaccatgcatgagcattttgttga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47452889 |
atgaatggaagtatgaggatcggcgtagtctaaggatgttgcaaaagtgacttttcgtctgttccaaggcagctacaaccatgcatgagcattttgttga |
47452988 |
T |
 |
| Q |
116 |
catgttctactttagcctgcattattataatatcgtggagattatttggttgatgtggaatttgtattttggcctgtagt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47452989 |
catgttctactttagcctgcattattataatatcgaggagattgtttggttgatgtggaatttgtattttggcctgtagt |
47453068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University