View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10629_5 (Length: 469)

Name: NF10629_5
Description: NF10629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10629_5
NF10629_5
[»] chr3 (3 HSPs)
chr3 (111-267)||(1109017-1109169)
chr3 (21-100)||(9123331-9123410)
chr3 (21-100)||(9131438-9131517)
[»] chr4 (1 HSPs)
chr4 (23-100)||(24525201-24525278)


Alignment Details
Target: chr3 (Bit Score: 127; Significance: 2e-65; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 111 - 267
Target Start/End: Original strand, 1109017 - 1109169
Alignment:
111 ctgtgaacgatggttcagacatatgaatgtgatctttgcagttcacaatgtgtctgaacagattgagatcaataatggcatggaaccccttcctgcagat 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1109017 ctgtgaacgatggttcagacatatgaatgtgatctttgcagttcacaatgtgtctgaacagattgagatcaataatggcatggaaccccttcctgcagat 1109116  T
211 gctacagatcatgtgcagagaaatacgtataaggatgtgaagaagaaagcatatatt 267  Q
    |||||||||   || |||||||||| |||||| ||||||||||||||||||||||||    
1109117 gctacagat---gt-cagagaaatatgtataacgatgtgaagaagaaagcatatatt 1109169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 21 - 100
Target Start/End: Original strand, 9123331 - 9123410
Alignment:
21 taactcccattatctcatcctttagaaccaaccctacaaatgtcttcaatggattcaacttgttgcaatcttgcagtgaa 100  Q
    |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
9123331 taactcccataatatcatcctttagaaccaaccctacaaatgtcttcaatggattcaacttgttgcaatcttgcaatgaa 9123410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 21 - 100
Target Start/End: Original strand, 9131438 - 9131517
Alignment:
21 taactcccattatctcatcctttagaaccaaccctacaaatgtcttcaatggattcaacttgttgcaatcttgcagtgaa 100  Q
    |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
9131438 taactcccataatatcatcctttagaaccaaccctacaaatgtcttcaatggattcaacttgttgcaatcttgcaatgaa 9131517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 70; Significance: 2e-31; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 23 - 100
Target Start/End: Original strand, 24525201 - 24525278
Alignment:
23 actcccattatctcatcctttagaaccaaccctacaaatgtcttcaatggattcaacttgttgcaatcttgcagtgaa 100  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
24525201 actcccataatctcatcctttagaaccaaccctacaaatgtcttcaatggattcaacttgttgcaatcttgcaatgaa 24525278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University