View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1062_low_8 (Length: 385)
Name: NF1062_low_8
Description: NF1062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1062_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 3e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 157 - 286
Target Start/End: Original strand, 36170857 - 36170986
Alignment:
| Q |
157 |
ttgtggaggaaacagacgaagggttagatagttttgctgttgtcaagtgttctttggatccacaacaagattttagagattcaatgattgagatgatcaa |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170857 |
ttgtggaggaaacagacgaagggttagatagttttgctgttgtcaagtgttctttggatccacaacaagattttagagattcaatgattgagatgatcaa |
36170956 |
T |
 |
| Q |
257 |
agagaaacatatcagtcagccagaagaaat |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36170957 |
agagaaacatatcagtcagccagaagaaat |
36170986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 8 - 86
Target Start/End: Original strand, 36170708 - 36170786
Alignment:
| Q |
8 |
gagcagagagctgcagaggaggaaaccaaagcagagttccaaggtaagagtacattctccaaagatggttactaaggtt |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36170708 |
gagcagagagctgcagaggaggaaaccaaagcagagttccaaggtaagagtacattctccaaagatggctactaaggtt |
36170786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 286
Target Start/End: Original strand, 5294798 - 5294904
Alignment:
| Q |
180 |
ttagatagttttgctgttgtcaagtgttctttggatccacaacaagattttagagattcaatgattgagatgatcaaagagaaacatatcagtcagccag |
279 |
Q |
| |
|
||||||||||||||||| | || ||||| | ||||| | || ||||||||||||||||||||||||||||| |||||||||| || ||| || ||| |
|
|
| T |
5294798 |
ttagatagttttgctgtgattaaatgttcatcaaatccaaagcaggattttagagattcaatgattgagatgattgaagagaaacagattagtaaggcag |
5294897 |
T |
 |
| Q |
280 |
aagaaat |
286 |
Q |
| |
|
||||||| |
|
|
| T |
5294898 |
aagaaat |
5294904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University