View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10630_high_2 (Length: 251)
Name: NF10630_high_2
Description: NF10630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10630_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 59 - 220
Target Start/End: Original strand, 3293773 - 3293933
Alignment:
| Q |
59 |
ctgcctgcataaaattttcatannnnnnnnactaccattgctagattttacctaagcaaaaacgatggtagatgtgaatgannnnnnnnnngtttgttga |
158 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
3293773 |
ctgcctgcacaaaattttcatattttttttactaccattgctagattttacctaagcaaaaacgatggtagatgtgaatga-tttttttttgtttgttaa |
3293871 |
T |
 |
| Q |
159 |
gaaagatatatgtgaacgatggcttttcattcatttaaaatatgagtactgtttctctgtat |
220 |
Q |
| |
|
| || |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3293872 |
ggaaaatatatgtgaacgatgacttttcattcatttgaaatatgagtactgtttctctgtat |
3293933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 176 - 241
Target Start/End: Complemental strand, 53232768 - 53232703
Alignment:
| Q |
176 |
gatggcttttcattcatttaaaatatgagtactgtttctctgtatgcagtgatttaatctcctatg |
241 |
Q |
| |
|
|||||||| |||| ||| |||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53232768 |
gatggcttatcatccatgtaaaatataagtactgtttctctacatgcagtgatttaatctcctatg |
53232703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 168 - 224
Target Start/End: Complemental strand, 50978093 - 50978037
Alignment:
| Q |
168 |
atgtgaacgatggcttttcattcatttaaaatatgagtactgtttctctgtatgcag |
224 |
Q |
| |
|
||||||| ||||||| |||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
50978093 |
atgtgaataatggcttatcattcatataaaatatgagtactgcttctctgtatgcag |
50978037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 40
Target Start/End: Original strand, 49391301 - 49391336
Alignment:
| Q |
5 |
tctaaaattacaacaataaatagggtatattttaaa |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
49391301 |
tctaaaattacaacaataaatagggtatattttaaa |
49391336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University